![Ped File Format Haploview Ped File Format Haploview](http://a.fsdn.com/con/app/proj/fcgene/screenshots/format_convert_genotype.png)
Before taking this tour, both Java and Haploview must be installed on your computer. Java Runtime Environment. You may find information and download links for the most recent JRE at: http:// NOTE: Haploview is.
Whole genome data analysis toolset. In this Section, we cover. PLINK is a Java program that provides a simple form interface to the. PLINK commands (i. PLINK provides menus and dialogs to create valid PLINK.
Important Only common PLINK commands are. PLINK forms. However it is possible to enter. PLINK command lines via PLINK - > Create Plink Command. PLINK. option has not been incorporated into g. PLINK. Alternatively, g. PLINK can be used to collate previously- generated. PLINK analysis, organizing the results and allowing for easier.
Haploview. Using g. PLINK in this "browse- only" mode.
- Data management Generate binary fileset--make-bed--make-bed creates a new PLINK 1 binary fileset, after applying sample/variant filters and other operations below. For example, plink --file text_fileset--maf 0.05--make-bed.
- Each.chr-*.map file produced by PLINK is a text file with no header line, and one line per variant with the following four fields: Variant identifier; Base-pair coordinate; Allele 1 (usually minor), 'X' if absent; Allele 2.
- Hello, I have a text file likes this: GTCAAAGATCAGATGGTTGTAGATGTGTGGTGTTATTTCTGAAGCCTCTGTTCAAGGAAGGCAGTTTCTTATGAA I want to convert it to a fasta file. Can we just manually add a '>' in the fist line? Thanks.
![Ped File Format Haploview Ped File Format Haploview](http://a.fsdn.com/con/app/proj/fcgene/screenshots/fcgene.png)
Documentation In this Section, we cover: Overview of gPLINK; Local versus remote modes; Starting a new project; Configuring gPLINK; Initiating PLINK jobs; Viewing PLINK output; Integration with Haploview; Miscellanea and known.
Please refer to the main PLINKdocumentation pages. PLINK provides can be used to initiate analysis from the five major domains. PLINK commands; the menu options are shown in the figure below. PLINK is currently considered stable, however from time to time there may be updates to add new PLINK commands. In g. PLINK, a project corresponds to a folder, either on the local machine or.
All output will be written to that folder. Each operation must.
PLINK keeps track of the commands run, and which files were. PLINK has three main panes: Folder viewer, Operation viewer and Log viewer. Folder viewer shows a list of the files in your current project. Left- clicking on the Folder viewer you can open files, launch Haploview, track the hierarchy of a file and edit file notations.
Operation viewer displays the operations recorded by g. PLINK, their associated input and output files as well as any operations notes.
Left- clicking on the Operations viewer will pop- up options to: open files, edit operation notes, unlink/link files to/from an operation, create a new PLINK operation, and delete operation. Log viewer shows the log file associated with the selected operation in the Operation viewer. You can run g. PLINK in one of two modes: either local or remote. In local mode. everything resides on the same machine: PLINK, g. PLINK, Haploview, the data and all computation. In remote mode, PLINK, the data files and all PLINK computation reside on a.
Unix/Linux machine, connected to the local machine via SSH. The. user runs the two Java- based tools g.
PLINK and Haploview on the local machine. Haploview. or any other local software. In remote mode, g. PLINK will use two project folders: one remote folder where all the. Any file in the. temporary folder can be deleted after the session finishes. If the remote server is also the head node of a cluster, and if jobs are sent to the.
PLINK can also send. To utilize remote mode, you need.
To have a Linux/Unix server with PLINK installed. To have access to this server via SSH (secure shell). The first step is always to create a local project folder by creating a new folder/directory.
If running in local. If running. in remote mode, this local folder will typically be empty, and it will just be used as.
On opening g. PLINK, you first select which local project folder you'll be using. File - > Set project folder option.
Next, you indicate whether the project will be local or remote. See the tour for more details on these steps. After you have opened your project folder, a configuration dialog will pop. Here you should set the PLINK path to point to. PLINK (plink. exe in Windows, otherwise. If in remote mode, you will be pointing to the copy of PLINK.
If you intend to use Haploview, you need to set the Haploview . You need. Haploview version 4. PLINK. The Editor options allows you to pick what command you wish to. This is an advanced feature and. Again, see the tour for more details on these steps. By this stage, you have started the project and configured g.
PLINK. You only need to. PLINK once at the start of each project. To initiate a PLINK job, select the appropriate menu option from the. PLINK menu. A dialog will be shown, in which you must. Specify the binary or standard fileset to be used for input. Specify a unique name for the output files. If there are files with the same root and the appropriate extensions, then you can select.
If you select an alternate phenotype, you must return the panel to either the binary or. Additionally, you can often optionally. Select an alternate phenotype file. Set filters and thresholds. Change other parameters relevant to the requested analysis. After clicking OK, you will be shown the corresponding PLINK. PLINK has generated given your choices.
You are. also given the option to add a description to this operation: this can be. After adding the description, you will be returned to the main window; the newly. This does not necessarily. PLINK command will be finished. Depending on the size of the.
PLINK analysis can take from seconds to. The command will run in the background. You can close g. PLINK and. PLINK command (or commands) will continue to run in the background. When you next open up g.
PLINK, if the analysis has finished. PLINK should automatically detect this and connect the output. Clicking on the operation will. PLINK. run; if the PLINK job has finished, then the log file will be complete, ending. You can view the result files by expanding the tree for the desired.
Alternatively you can select the file from the Folder. You will be given a choice to view the file in the. The default viewer depends on the machine type. Word. Pad, Text. Edit or emacs for Windows, Mac and.
Linux/other systems respectively. The alternate viewer can be set to anything. Configuration menu option. If in the Configuration panel you pointed. PLINK to an instance of Haploview (version 4), then an Open in.
Haploview option will also appear. For results files, this will bring up the. Haploview. You can filter and sort results here as well as merging. You can also generate plots of results very easily. SNP, or individual, the point represents; clicking on the. It is also possible to extract subsets of your whole genome SNP data files for. Haploview (i. e. viewing data rather than results of PLINK runs).
Use the. Data management - > Generate fileset - > Haploview fileset option for this. Then. right- clicking on either the . Haploview will load the data into Haploview.
Note: use the filters to select. Haploview (i. e. restrict the number of SNPs. How do I kill a PLINK process initiated by g.
PLINK? When you run a PLINK command from g. PLINK. a separate PLINK program is started independent of. PLINK. This means that you can close g. PLINK and your. operation will run to completion.
It also means that if you decide to. PLINK operation you will need to do so through your. Linux or through Task. Manager in Windows).
Manual Rescan folder option. The menu option Rescan folder checks the project folder. PLINK commands. Typically this rescanning. Configuration. dialog. This option is for the inpatient, therefore.
Quirks, known issues. In no particular order. All input files must have an extension (contain a period .) if. Do not attempt to use different machines with different architecture. That is, in this case, PLINK would be running in "local" mode. Java 1. 5 is required to run g. PLINK. You first need up- to- date versions of Java, PLINK and Haploview on your.
Please follow all 4 of these steps. You will need Java 1. Sun. website, for all common platforms.
To download Java, follow this link. Download Now. You need PLINK version 0. PLINK. which can be downloaded from here. A beta version of Haploview that supports g.
PLINK can be. obtained from this page. After completing the above three steps, download the latest g.
PLINK. (version 2. JAR file (as a. zipped archive).
If you download this file, please refer to the GPL v. Source code is available upon request, and will soon be posted. If you have downloaded the ZIP file, you must first extract the contents (a single JAR. In Windows, double- clicking on the g. PLINK. jar file should probably work. If not (and on all other platforms), typing at the command line prompt. PLINK. jar. will start g.
PLINK (you must be in the directory where g. PLINK. jar is. or specify it's location explicitly; likewise, java must be in your path; please. For interested developers the source code can be found here.
Note that most users do not need the source code!